Genetic Diversity of Viruses Associated with Sugarcane Mosaic Disease of Sugarcane Inter-Specific Hybrids in China
Yuliang Zhang1,2 ()
Qixing Huang1 ()
Guohua Yin1,3* ()
Ruizong Jia1 ()
Samantha Lee3 ()
Guoru Xiong1,2 ()
Naitong Yu1 ()
Kayla K. Pennerman3 ()
Zhixin Liu1,2 ()
Shuzhen Zhang1,2* ()
Affiliations:
1Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou, Hainan 5711001, China
2Sugarcane Research Center, Chinese Academy of Tropical Agricultural Sciences, Haikou, Hainan 5711001, China
3Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901, USA
*Corresponding authors: SZZ and GHY
No. 4 Xue Yuan road, Long Hua district, Haikou, Hainan 571101, China, Phone: +86-898-66890770; Fax: +86-898-66987892, Email: or
The authors declare that there is no conflict of interest.
Abstract
In this study, we investigated 78 sugarcane samples with severe mosaic symptoms collected from four provinces of southern China: Guangxi, Yunnan, Hainan, and Guangdong, which cover nearly 85% of commercial sugarcane planting zones in China. Using RT-PCR, sequencing and phylogenetic analysis, we identified 72 hybrid sugarcane samples containing causal agents of sugarcane mosaic disease. Among these, 66 virus isolates were identified as Sorghum mosaic virus (SrMV) (84.6%), four were identified as Sugarcane streak mosaic virus (SCSMV) (5.1%), and two were identified as Sugarcane mosaic virus (SCMV) (2.6%). The isolates of SrMV were classified into three subgroups: I, II, and III with a 95% similarity level. The two largest subgroups, SrMV I containing 36 viruses which caused sugarcane mosaic diseases isolates (46.2%), and SrMV III containing 20 isolates (25.6%), were prevalent in Guangdong and Guangxi provinces; however, SrMV II containing five5 isolates (6.4%) did not exhibit any close association with geographical distribution. The popular sugarcane cultivar, ROC22, was found to be infected with all the three subgroup types of SrMV. According to our knowledge, this is the first reported detection of the co-infection of SrMV and SCSMV in Saccharum hybrid (YN-bs-9). Recombination analysis indicated recombination between different isolates mostly occurring in Yunnan and Guangxi provinces among the SrMV I group. This study provides insight into the species diversity and geographical distribution of causal agents of sugarcane mosaic disease, and provides the basis for its identification, prevention, and future control efforts.
Note: The nucleotide sequences are available in GenBank with the accession numbers from KC179632 to KC179707.
Keywords: sugarcane mosaic disease, Saccharum hybrids, phylogenetic diversity
Abbreviations list:
SMD: Sugarcane mosaic disease
SCMV: Sugarcane mosaic virus
SrMV: Sorghum mosaic virus
SCSMV: Sugarcane streak mosaic virus
CP: Coat protein
Introduction
Sugarcane is a worldwide economically- important crop. In southern China, Saccharum hybrids are widely grown and contribute to more than 85% of sugar production in China (Xu et al. 2008). Numerous pathogens affect sugarcane including fungi, viruses, bacteria and nematodes, causing consistent sugarcane yield losses. Of these, viruses are one of the most important causes of disease epidemics resulting in significant economic losses to the sugarcane industry (L. G. Li et al. 2008; Parameswari et al. 2013). In 1892, sugarcane mosaic disease (SMD) was first identified and later shown to be caused by a potyvirus in Java (Indonesia) (Artschwager and Brandes 1958). The causal agents of SMD were later identified as three viruses of Potyviridae including, Sugarcane mosaic virus (SCMV), Sorghum mosaic virus (SrMV) and Sugarcane streak mosaic virus (SCSMV) (Shukla et al. 1992; Pirone and Anzalone 1966; Hema et al. 1999). They have the ability to infect sugarcane under natural conditions, and this led to the development of interspecific Saccharum hybrids in order to control the rapid spread of the disease in sugarcane-growing countries (Perera et al. 2009; Srinivas et al. 2010).
In China, SMD causes significant yield losses and threatens the survival of the sugarcane industry (Q. J. Chen et al. 1998). In 1979, SCMV was first reported in the Zhejiang province and the virus was later found in Fujian and Guangxi provinces in 1988 (Q. J. Chen et al. 1998; Lu et al. 1981). SCMV has also been purified and characterized by several research groups (Q. J. Chen et al. 1998; L. J. Li et al. 2000; Y. L. Zhang et al. 2012; Yao et al. 2004). SCSMV was first reported in India (Hema et al. 1999) and later in other Asian countries (Hema et al. 2002). In recent years, three SCSMV isolates were found in sugarcane plants imported from Japan and Indonesia, and were allowed to grow in a quarantine zone at the National Nursery for Sugarcane Germplasm Resources in Kaiyuan, Yunnan province (J. Chen et al. 2002). Whole genome sequence analyses indicated that these isolates from China were distinct from the previously described SCSMV-PAK and SCSMV-India isolates suggesting that they represented new strains of SCSMV (W. Li et al. 2011).
Previous studies suggest that the diversity of viruses belonging to Potyviridae is related to the variations of the coat protein (CP) genes (Adams et al. 2005). The molecular variations in the CP genes showed that SCMV, SrMV, and SCSMV are genetically diverse depending on the different geographical distributions (Alegria et al. 2003). In this study, we surveyed 78 samples from Saccharum hybrids and S. officinarum, and examined them for the presence of SMD related viruses. The study focused on the host preference of SCMV, SrMV and SCSMV among the sugarcane cultivars, the diversity of SMD viruses, and the virus distribution in four provinces of China.
Materials and Methods
Samples and locations
A total of 78 samples representing 44 sugarcane cultivars with severe mosaic symptoms was collected during the growing season from September to October 2011. The samples were stored at -80°C until further analysis. Samples were collected in four major sugarcane growing provinces in China, Guangxi, Yunnan, Hainan, and Guangdong covering 85% of sugarcane planting areas.
Detection of SrMV, SCMV, and SCSMV
Samples of sugarcane leaves were frozen in liquid nitrogen and ground for RNA extraction. Total RNA was extracted using the Plant RNA Kit (Omega, USA) according to the manufacturer’s instructions. DNA was removed by DNase I treatment (Takara, China) prior to cDNA synthesis. The cDNA first strand was synthesized using reverse transcriptase (M-MLV) (TransGen, China) with a combination of random primers and oligo-dT primers according to the manufacturer’s instructions. Table 1 summarizes all the virus coat protein (CP) gene specific primers developed in this work to detect SrMV, SCMV, and SCSMV. Other utilized primers include SCMV-CP2, SCMV-F3-R3, SCMV-F4-R3(Alegria et al. 2003; Xu et al. 2008), SrMV-CP1 and SrMV-CP2 (Y. Zhang et al. 2015), and the universal primer pair M13-47/RV-M. PCR reactions contained 1 μlL of cDNA, 0.5 μlL of each specific primer (10 μM), 2 μlL of 10 × PCR buffer, 1 μlL of 2.5 mM dNTPs, 0.25 units of Ex-Taq DNA polymerase (Takara, China) with ddH2O added to a final volume of 20 μlL. The amplification cycle was performed as follows: 94°C for 3 min, and 35 cycles at 94°C for 30 s, 50°C for 30 s, and 72°C for 1 min and with a final elongation at 72°C for 10 min. PCR products were electrophoresed on a 1% agarose gel at 80 V for 20 min and visualized with Goldview dye (Beijing SBS Genetech, China).
Table 1 The primers used to detect viral agents of sugarcane mosaic disease.
Primersa / Target Genes / Sequences (5’→3’) / Reference (Accession No. in GenBank)SCMV-CP1 / SCMV CP / TCCGGAACTGTGGATGCAGGAGCCC (8400-8424) / This work (NC_003398)
GTGGTGCTGCTGCACTCCCAACAGA (9314-9338)
SCMV-F5-R5 / SCMV CP / GAGTTTGATAGGTGGTATGAAGCC (8799-8822) / This work (NC_003398)
CTTTCATCTGCATGTGGGC (9180-9198)
SCSMV-Nib* / SCSMV Nuclear
Inclusion b / AGTAAGCATACAGGAAAAGAGGGGT (8588-8612) / This work (GQ388116)
TCAGTGCTGGGCGCGCCCAAAATGA (9568-9592)
SCSMV-CP / SCSMV CP / GTCAAGCAGGGAGTCAAACAAC (8817-8838) / This work (GQ388116)
ACGAACCGAGAACTGAACCCAC (9286-9307)
aAll primers have annealing temperature between 50-55 oC.*We designed primers targeting the Nib gene of SCSMV as an alternative to primers targeting the CP which may not work due to strain sequence diversity.
Cloning and sequencing of SCMV, SrMV, and SCSMV isolates
RT-PCR products of the CP gene fragments of SCMV, SrMV, and SCSMV were purified using a Gel Extraction Kit (TianGen, China), cloned into the vector pMD19-T (Takara, China), and transformed into Escherichia coli DH5α (Froger and Hall 2007). Positive colonies were identified using universal primers M13-47 and RV-M. Three positive colonies from each transformation were selected and sequenced using the automated ABI 3130xl Genetic Analyzer (Applied Biosystems, USA). The aligned consensus sequence was considered as the correct sequence of an isolate sample and submitted to GenBank. Sequence analysis was performed using DNAMAN software (5.2.9 Demo version, Lynnon BioSoft, Canada). Phylogenetic trees were constructed using MEGA 6 (Tamura et al. 2013). To identify the sequence, we compared our nucleotide sequences of the CP genes to CP sequences available in GenBank. The genetic diversity of the isolates was determined by alignment with ClustalX using the neighbor-joining option with a bootstrap analysis of 1,000 random replications (Larkin et al. 2007). Statistical analysis using SPSS (v14, USA) was performed to predict the correlation between virus diversity and geographical distribution in China.
Recombination analysis of SrMV isolates
Partial coat protein nucleotide sequences of SrMV isolates were analyzed for recombination events. We downloaded 88 partial coat protein nucleotide sequences of SrMV isolates from NCBI GenBank, excluding those sequences labeled as “nonfunctional”, those not explicitly labeled “coat protein” or “capsid protein”, and those that are < 700 nt or > 1,000 nt. This set included 60 sequences from our work and 28 from other groups. The majority of the isolate sequences were found in China. Twelve isolates were from Argentina, seven were from Paraguay, and one isolate was from the United States of America. ClustalW was used to perform multiple alignments at default settings. The Recombination Detection Program (RDP v4.44, was used to perform recombination analysis. The algorithms RDP, GENECONV, BootScan, MaxChi, CHIMAERA, SIScan and 3Seq were used and sequences were set to linear. All other parameters were at default settings. Only hypothetical recombination events detected by at least 5 algorithms were considered.
Results and Discussion
Sample collection and detection of SCMV, SrMV, and SCSMV
For the 78 samples, 33, 6, 37, and 2 were from Guangxi, Hainan, Yunnan, and Guangdong provinces, respectively (Figure 1).
Figure 1 Incidence of three viruses causing SMD in inter-specific sugarcane hybrid producing areas in China.
We determined the association of virus infection with the symptoms of sugarcane mosaic disease, by identifying SCMV-, SrMV-, and SCSMV-specific coat protein fragments amplified by RT-PCR. Seventy-two isolates were sequenced including 66 SrMV (84.6%), four4 SCSMV (5.1%), and two2 SCMV (2.6%). As summarized in supplementary Table 1, 72 sugarcane samples (92.3%) out of 78 samples exhibited a high level of mosaic virus infection. Our results suggest that the main viral species causing SMD in China is SrMV; only one sample from Baoshan in Yunnan province (YN-bs-9) was found to be co-infected by two distinct virus species (SrMV and SCSMV).
1
Supplementary Table 1Detected sugarcane mosaic disease-associated viral coat protein sequences in leaf samples of different sugarcane cultivars.
No. / Isolates / Host cultivarsa / Size (bp) / Virusesb / City/Statec / Accession No. / Blast-Nd(Accession No.)1 / GX-bh-1 / ROC22 / 913 / SrMV / Beihai, GX / KC179632 / 0.98 (FM997898.1)
2 / GX-bh-2 / ROC28 / 913 / SrMV / Beihai, GX / KC179633 / 0.96 (DQ925433.1)
3 / GX-bh-3 / Liucheng05-136 / 913 / SrMV / Beihai, GX / KC179634 / 0.98 (FM997898.1)
4 / GX-bh-4 / Guitang02-467 / 892 / SrMV / Beihai, GX / KC179635 / 0.96 (DQ925433.1)
5 / GX-bh-5 / Funong38 / 892 / SrMV / Beihai, GX / KC179636 / 0.96 (DQ925433.1)
6 / GX-nn-1 / ROC22 / 913 / SrMV / Nanning, GX / KC179637 / 0.98 (FM997898.1)
7 / HN-lg-1 / ROC22 / 913 / SrMV / Lingao, HN / KC179638 / 0.99 (FM997906.1)
8 / HN-lg-2 / Yunzhe05-51 / 913 / SrMV / Lingao, HN / KC179639 / 0.99 (FM997902.1)
9 / HN-lg-3 / Funong39 / 913 / SrMV / Lingao, HN / KC179640 / 0.99 (FM997906.1)
10 / HN-lg-4 / Yuetang93-159 / 913 / SrMV / Lingao, HN / KC179641 / 0.99 (FM997906.1)
11 / HN-lg-5 / Yunzhe01-1413 / 937 / SrMV / Lingao, HN / KC179642 / 0.94 (U57360.1)
12 / YN-lCh-5 / ROC22 / 937 / SrMV / LongChuan, YN / KC179643 / 0.97 (FM997909.1)
13 / YN-rl-1 / Yuetang86-368 / 937 / SrMV / Ruili, YN / KC179644 / 0.98 (FM997908.1)
14 / YN-lCh-1 / Chuantang79-15 / 938 / SrMV / LongChuan, YN / KC179645 / 0.98 (FM997909.1)
15 / YN-lCh-2 / Mintang90-1022 / 893 / SrMV / LongChuan, YN / KC179646 / 0.97 (FM997897.1)
16 / YN-lCh-3 / Yuetang93-159 / 937 / SrMV / LongChuan, YN / KC179647 / 0.96 (FM997897.1)
17 / YN-rl-2 / Yuetang93-159 / 913 / SrMV / Ruili, YN / KC179648 / 0.99 (FM997903.1)
18 / YN-bs-5 / Yunzhe03-258 / 913 / SrMV / Baoshan, YN / KC179649 / 0.98 (FM997898.1)
19 / YN-bs-6 / Yuetang86-368 / 913 / SrMV / Baoshan, YN / KC179650 / 0.99 (FM997903.1)
20 / YN-bs-3 / ROC25 / 913 / SrMV / Baoshan, YN / KC179651 / 0.99 (AJ310196.1)
21 / YN-bs-1 / Funong39 / ND / ND / Baoshan, YN / NA / NA
22 / YN-bs-7 / Yunzhe03-194 / 913 / SrMV / Baoshan, YN / KC179652 / 0.96 (DQ925433.1)
23 / YN-bs-2 / Yunzhe99-91 / 447 / SCSMV / Baoshan, YN / KC179701 / 0.99 (JQ954717.1)
24 / YN-bs-8 / Yunzhe01-1413 / 913 / SrMV / Baoshan, YN / KC179653 / 0.98 (FM997903.1)
25 / YN-bs-9e / Liucheng05-136 / 937; 447 / SrMV, SCSMV / Baoshan, YN / KC179654
KC179702 / 0.98 (EF419179.1)
0.99 (JQ954717.1)
26 / YN-bs-4 / ROC15 / 932 / SrMV / Baoshan, YN / KC179655 / 0.98 (KC576803.1)
27 / YN-bs-10 / Yunzhe03-194 / 913 / SrMV / Baoshan, YN / KC179656 / 0.97 (FM997898.1)
28 / YN-lCh-6 / Yunzhe99-91 / 913 / SrMV / LongChuan, YN / KC179657 / 0.99 (FM997898.1)
29 / YN-lCh-4 / Yingyu91-59 / 913 / SrMV / LongChuan, YN / KC179658 / 0.99 (FM997898.1)
30 / YN-bs-11 / Yunyin58 / 447 / SCSMV / Baoshan, YN / KC179703 / 0.99 (JQ954717.1)
31 / GX-lb-4 / Guitang29 / ND / ND / Laibin, GX / NA / NA
32 / GX-lb-5 / Funong38 / ND / ND / Laibin, GX / NA / NA
33 / GX-lb-6 / ROC22 / ND / ND / Laibin, GX / NA / NA
34 / GX-lb-7 / Funong1110 / ND / ND / Laibin, GX / NA / NA
35 / GX-cz-1 / Yuetang60 / 912 / SrMV / Chongzuo, GX / KC179659 / 0.98 (FM997898.1)
36 / GX-cz-2 / Funong15 / 937 / SrMV / Chongzuo, GX / KC179660 / 0.93 (U57360.1)
37 / GX-cz-3 / Yunzhe05-49 / 956 / SCSMV / Chongzuo, GX / NA / NA
38 / GX-cz-4 / Liucheng05-136 / 913 / SrMV / Chongzuo, GX / KC179661 / 0.96 (EF419178.1)
39 / HN-dz-6 / Yunzhe05-469 / 343 / SrMV / Danzhou, HN / KC179694 / 0.99 (EF580920.1)
40 / GX-hc-1 / Guitang29 / 343 / SrMV / Hechi, GX / KC179695 / 0.94 (DQ922903.1)
41 / GX-hc-2 / Guitang02-208 / 343 / SrMV / Hechi, GX / KC179696 / 0.99 (EF580920.1)
42 / GX-lb-2 / Funong39 / 343 / SrMV / Laibin, GX / KC179697 / 0.99 (EF419178.1)
43 / GX-lb-1 / ROC22 / 937 / SrMV / Laibin, GX / KC179663 / 0.92 (KC576803.1)
44 / GX-lb-3 / ROC22 / 343 / SrMV / Laibin, GX / KC179699 / 0.97 (JX099765.1)
45 / GX-bh-6 / ROC05-3031 / 892 / SrMV / Beihai, GX / KC179664 / 0.98 (FM997903.1)
46 / GX-bh-7 / Liucheng05-136 / 892 / SrMV / Beihai, GX / KC179665 / 0.96 (DQ925433.1)
47 / GD-zj-1 / Liucheng03-182 / 913 / SrMV / Zhanjiang, GD / KC179666 / 0.98 (FM997898.1)
48 / GD-zj-2 / ROC92-2668 / 913 / SrMV / Zhanjiang, GD / KC179667 / 0.96 (DQ925433.1)
49 / GX-nn-2 / Liucheng05-136 / 913 / SrMV / Nanning, GX / KC179668 / 0.98 (FM997898.1)
50 / GX-nn-3 / ROC22 / 913 / SrMV / Nanning, GX / KC179669 / 0.99 (FM997906.1)
51 / GX-gl-1 / Funong39 / 913 / SrMV / Guilin, GX / KC179670 / 0.98 (FM997898.1)
52 / GX-gl-2 / Funong30 / 913 / SrMV / Guilin, GX / KC179671 / 0.96 (DQ925433.1)
53 / GX-gl-3 / Yuegan24 / 913 / SrMV / Guilin, GX / KC179672 / 0.96 (DQ925433.1)
54 / GX-gl-4 / Yunzhe03-103 / 913 / SrMV / Guilin, GX / KC179673 / 0.98 (FM997903.1)
55 / GX-gl-5 / ROC22 / 913 / SrMV / Guilin, GX / KC179674 / 0.96 (FM997898.1)
56 / GX-gl-6 / Yuetang94-128 / 913 / SrMV / Guilin, GX / KC179675 / 0.99 (FM997906.1)
57 / GX-gl-7 / Funong15 / 913 / SrMV / Guilin, GX / KC179676 / 0.99 (FM997901.1)
58 / GX-gl-8 / Saccharum officinarum / 856 / SCMV / Guilin, GX / KC179706 / 0.89 (DQ316256.1)
59 / GX-gl-9 / Saccharum officinarum / 856 / SCMV / Guilin, GX / KC179707 / 0.90 (AJ310104.1)
60 / GX-gl-10 / Saccharum officinarum / 913 / SrMV / Guilin, GX / KC179677 / 0.98 (FM997903.1)
61 / YN-lc-1 / Funong39 / 913 / SrMV / Lincang, YN / KC179678 / 0.99 (FM997906.1)
62 / YN-lc-2 / ROC22 / 937 / SrMV / Lincang, YN / KC179679 / 0.95 (U57358.2)
63 / YN-lc-3 / Guitang28 / 913 / SrMV / Lincang, YN / KC179680 / 0.96 (DQ925433.1)
64 / YN-lc-4 / Yuetang60 / 913 / SrMV / Lincang, YN / KC179681 / 0.98 (FM997898.1)
65 / YN-ky-1 / Funong91 / 937 / SrMV / Kaiyuan, YN / KC179682 / 0.95 (U57358.2)
66 / YN-lc-5 / Yuetang96-868 / 937 / SrMV / Lincang, YN / KC179683 / 0.95 (U57358.2)
67 / YN-lc-6 / Yuetang95-168 / 913 / SrMV / Lincang, YN / KC179684 / 0.99 (FM997906.1)
68 / YN-ky-2 / Guitang17 / 913 / SrMV / Kaiyuan, YN / KC179685 / 0.99 (FM997903.1)
69 / YN-lc-7 / Funong28 / 913 / SrMV / Lincang, YN / KC179686 / 0.98 (AJ310196.1)
70 / YN-ky-3 / ROC22 / ND / ND / Kaiyuan, YN / NA / NA
71 / YN-ky-4 / Yunzhe99-91 / 937 / SrMV / Kaiyuan, YN / KC179687 / 0.95 (U57358.2)
72 / YN-lc-8 / Yuetang93-159 / 937 / SrMV / Lincang, YN / KC179688 / 0.95 (U57358.2)
73 / YN-ky-5 / Funong91-2641 / 937 / SrMV / Kaiyuan, YN / KC179689 / 0.95 (U57358.2)
74 / YN-lc-9 / Guitang02-901 / 937 / SrMV / Lincang, YN / KC179690 / 0.94 (U57358.2)
75 / YN-lc-10 / Yunzhe99-91 / 937 / SrMV / Lincang, YN / KC179691 / 0.99 (EF419179.1)
76 / YN-lc-11 / ROC22 / 913 / SrMV / Lincang, YN / KC179692 / 0.99 (FM997898.1)
77 / YN-ky-6 / Yuetang93-159 / 343 / SrMV / Kaiyuan, YN / KC179700 / 0.97 (FM997898.1)
78 / YN-lc-12 / Yuetang91-1102 / 937 / SrMV / Lincang, YN / KC179693 / 0.95 (KC576803.1)
aAll the sugarcane cultivars are hybrid except the cultivar with the numbers of 58, 59 and 60 (underlined).
bSCMV: Sugarcane mosaic virus, SrMV: Sorghum mosaic virus, SCSMV: Sugarcane streak mosaic virus, ND: not detected by RT-PCR,NA: not applicable.
cProvince names abbreviated as follows: YN for Yunnan, HN for Hainan, GD for Guangdong, and GX for Guangxi.
dNCBI blastn ( results present as maximum identity in percentage (%), following by matched GenBank accession numbers.
eBold font indicates the only sugarcane leaf sample with SrMV and SCSMV co-infection.
1
The combination of RT-PCR with sequencing was necessary for the detection of viruses in sugarcane in China because many SrMV isolates and SrMV molecular variants could belong to a single genotype group. Sequence analysis of the CP genes accurately identified the genotype or strain of SrMV.
In our study, SMD was found to be widely distributed in southern China, particularly among inter-specific hybrids of sugarcane. Our two specific primer pairs for RT-PCR showed a high occurrence rate of SrMV in the inter-specific hybrids grown in the Guangxi, Yunnan, Hainan, and Guangdong provinces, and these results were consistent with a previous study reported by Li et al (2011). While the primer pairs usually yielded coat protein sequences over 900 base pairs, some sequences were as low as 343 bp. Interestingly, we did not detect SCMV in the sugarcane inter-specific hybrid but did in S. officinarum, indicating that SrMV was the dominant virus infecting sugarcane in China. Infection by SrMV was also observed in multiple cities in the Yunnan province. SCSMV-infected sugarcane originally imported from Japan and Indonesia are grown only in the quarantine facilities in the National Nursery for Sugarcane Germplasm Resources in Kaiyuan, Yunnan province (J. Chen et al. 2002), but the virus was also detected in the Guangxi province in this study. Overall, our studyraises urgent questions regarding how widespread is the SrMV epidemic and how to control it.
Phylogenetic divergence of SMD viruses
A phylogenetic tree was constructed based on the 913 base pair nucleotide sequence alignment of the core region of the CP genes from samples containing SrMV or SCMV. In addition, we also compared the whole length genome sequences from GenBank and included fifteen published sequences of SCMV and two published sequences of SrMV (Figure 2). As expected, the isolates of SrMV and SCMV were clustered independently and SrMV showed great divergence. As seen in Figure 2, the isolates of SrMV (84.6%) clustered into 3 subgroups: I, II, and III with a 95% similarity level. The largest group, SrMV group I, contained 36 isolates (46.2%), while SrMV group III contained 20 different isolates (25.6%). The smallest group, SrMV group II, contained five different isolates (6.4%).
Figure 2 The divergence of the SrMV and SCMV viruses.
Our results indicate that the genetic diversity of SrMV is high among sugarcane inter-specific hybrids in China. The composition of SrMV populations also was shown to vary geographically among the provinces of Guangxi, Yunnan, Hainan, and Guangdong in China. Two SCMV samples were clustered differently from SrMV and SCMV reference strains and this may be caused by the difference in host cultivars. In our study, SCMV samples were isolated from S. officinarum, but not from Saccharum hybrids.
In this study, four SCSMV isolates also were found in the sugarcane-growing areas (Figure 3). The SCSMV had much shorter sequences than SrMV or SCMV, which were generally > 900 bp. Instead, these isolates were analyzed for phylogenetic relationships only with other previously found SCSMV isolates. GX-cz-3 was closely related to Indonesian isolates (99.28%) but less related to the Japanese isolates JP1 and JP2. The three SCSMV isolates YN-bs-2, YN-bs-9, and YN-bs-11 were closely related to the isolates reported by He et al (2013).
Figure 3 The divergence of the SCSMV virus.
Geographical distribution of SMD
The correlation between SMD, virus diversity and geographical distribution was also analyzed using SPSS (Figure 4A). We found distinct geographical distributions of the different phylogenetic groups shown in Figures 2 and 3. SCSMV was mainly distributed in the Yunnan province, SrMV group III prevailed in the Guangxi province, and SrMV group I was mainly found in the Guandong province. We did not find distinct geographical distributions for SrMV group II and SCMV.
Figure 4 Geographical distribution of the viruses involved in SMD.
Recombination analysis of SrMV isolates
The relatively large number of available SrMV coat protein sequences prompted us to attempt recombination analysis. Results of recombination analysis are shown in Table 2. Eight possible recombinants from a minimum of three recombination events were detected. None of the recombination events included isolates found by other groups. Pairwise similarity (between recombinant and either parent, and between parents) graphs were generated by RDP (Figure 5). GX-nn-3, YN-1c-5, GX-gl-5, and YN-bn-10 belong to SrMV group I; GX-cz-4-2 and YN-bs-8 belong to SrMV II and SrMV III, respectively (Figure 2). If these are true recombinants, then detectable recombination events mostly occurred in Yunnan and Guangxi provinces among isolates of the SrMV group I.
Table 2 SrMV recombinants and their parents detected by Recombination Detection Program.
Recombinant Sequence / Major Parent / Minor Parent / Breakpoint Range / Algorithms / p-valueYN-lc-8 / YN-bs-6 (99.2%) / ud / ud-607 / RDP / 2.668E-17
GENECONV / 6.330E-17
BootScan / 8.299E-5
MaxChi / 1.566E-13
Chimaera / 3.878E-13
SIScan / 4.599E-5
3Seq / 1.049E-31
GX-cz-2 / YN-bs-8 (81.6%) / GX-cz-4-2 (83.8%) / 882-240 / RDP / 1.944E-2
MaxChi / 1.021E-2
Chimaera / 9.993E-1
SIScan / 1.720E-19
3Seq / 1.224E-2
GX-lb-1-1 / GX-cz-4-2 (94.6%) / YN-bs-8 (88.8% ) / ud-266 / RDP / 1.944E-2
MaxChi / 1.021E-2
Chimaera / 9.993E-1
SIScan / 1.720E-19
3Seq / 1.224E-2
YN-lc-10 / YN-bs-8 (81.2%) / GX-cz-4-2 (81.4%) / 874-224 / RDP / 1.944E-2
MaxChi / 1.021E-2
Chimaera / 9.993E-1
SIScan / 1.720E-19
3Seq / 1.224E-2
YN-lc-2 / YN-bs-8 (80.7%) / GX-cz-4-2 (81.7%) / 874-224 / RDP / 1.944E-2
MaxChi / 1.021E-2
Chimaera / 9.993E-1
SIScan / 1.720E-19
3Seq / 1.224E-2
YN-ky-1 / ud / GX-cz-4-2 (81.9%) / ud-253 / RDP / 1.944E-2
MaxChi / 1.021E-2
Chimaera / 9.993E-1
SIScan / 1.720E-19
3Seq / 1.224E-2
YN-bs-10 / ud / YN-lc-5 (99.6%) / 246-ud / GENECONV / 1.818E-2
MaxChi / 1.938E-6
Chimaera / 1.413E-7
SIScan / 1.461E-9
3Seq / 4.502E-9
GX-gl-5 / GX-nn-3
(98%) / YN-lc-5 (99.6%) / ud-ud / GENECONV / 1.818E-2
MaxChi / 1.938E-6
Chimaera / 1.413E-7
SIScan / 1.461E-9
3Seq / 4.502E-9
Notes: Results are shown as obtained from RDP. Similarities to major and minor parents are included as percentages; ud means the information was undetermined.