Profiling Bacterial Diversity and Taxonomic Composition on Speleothem Surfaces in Kartchner

Profiling Bacterial Diversity and Taxonomic Composition on Speleothem Surfaces in Kartchner Caverns, AZ

Marianyoly Ortiz1, Julia W. Neilson1, William M. Nelson2, Antje Legatzki1, Andrea Byrne1, Yeisoo Yu3, Rod A. Wing3, Carol A. Soderlund2, Barry M. Pryor3, Leland S. Pierson III4 and Raina M. Maier1*

1Department of Soil, Water and Environmental Science, 2BIO5 Institute, 3Department of Plant Sciences,University of Arizona, Tucson, AZ 85721

4Department of Plant Pathology and Microbiology, Texas A&M University, College Station, TX, USA

For submission to

Microbial Ecology

Submitted July 16, 2012

Running Title:

Bacterial diversity in Kartchner Caverns

Key Words: carbonate cave, pyrosequencing, oligotrophic, clone library, 16S rRNA

*Corresponding author:

Raina M. Maier

Department of Soil, Water and Environmental Science

Shantz Bldg Room 429

1177 E. 4th Street

University of Arizona

Tucson, AZ 85721-0038

Phone: 520-621-7231

Fax: 520-626-6782

Electronic Supplementary Material

Supplementary Figure1: Rarefaction curves of OTU clusters at 97% similarity.

1

Supplementary Table 1: DNA sequences of the most abundant 454-pyrotag OTUs

OTU / DNA sequence
1 / TAGGTTTGACATATAGAGAAAACTTATAGAGATATAAGGTCCTTTTGGGCTCTATACAGGTGGTGCATGGCTGTC
2 / TGGGTTTGACATCTGGCGAATCCCCATGAAAGTGGGGAGTGCCCGCAAGGGAGCGCCAAGACAGGTGCTGCATGG
3 / AAGGCTTGACATATACCGAAAACTGGCAGAGATGTCAGGTCCGCAAGGGCGGTATACAGGTGGTGCATGGCTGTC
4 / TAGGTTTGACATATAGAGAAAACTTATAGAGATATAAGGTCCTTTTGGGCTCTATACAGGTGGTGCATGGTTGTC
5 / TGGGTTTGACATCTGGCGAATCCCCATGAAAATGGGGAGTGCCCGCAAGGGAGCGCCAAGACAGGTGCTGCATGG
6 / TGGGCTTGAACTGTGGTGGACGGCGGGTGAAAGCTCGCTTCTTCTTCGGAAGCTGCCACAGAGGTGCTGCATGGC
7 / TGGGCTTGACATGCTAGGAAGTCTGCAGAGATGCGGATGTGCCCGCAAGGGAACCTAGACACAGGTGCTGCATGG
8 / AAGGCTTGACATATACCGAAAACTGGCAGAGATGTCAGGTCCGCAAGGGCGGTATACAGGTGGTGCATGGTTGTC
9 / CAGGCTCGAAATGCAGGTGACAGGCGGTGAAAGCCGCTTTCCGCAAGGACACCTGTATAGGTGCTGCATGGCTGT
10 / AGGGCTTGACATACTGACTCAAGCTTATGTGAAAGCATGGAGTGGTGTGAAGCTTGCTTTACACAGTTAGTACAG
11 / TGGGCTTGACATGTTCCTGACCGGTGTGGAAACACACCTTCCCTTCGGGGCAGGATCACAGGTGGTGCATGGCTG
12 / TGGGCTTGACATGCACGGGAAAGCTGGTGGAAACACTGGTCCCTCTTCGGAGCTCGTGCACAGGTGCTGCATGGC
13 / AGCGTTTGACATCCTCATCGCGGTTTCCAGAGATGGATTCCTTCAGTTCGGCTGGATGAGTGACAGGTGCTGCAT
14 / CAGGCTCGAAATGCAGGTGACAGGCGGTGAAAGCCGCTTTCCGCAAGGACACCTGTATAGGTGCTGCATGGTTGT
15 / AGGGCTTGACATGCACCGGAAAGCCGTAGAAATACGGCCCTCCTTCGGGACTGGTGCACAGGTGGTGCATGGCTG
16 / TGGGCTTGAACTGTGGTGGACGGCGGGTGAAAGCTCGCTTCTTCTTCGGAAGCTGCCACAGAGGTGCTGCATGGT
17 / TACCCTTGACATCCCAGGAATCCTTCAGAGATGAGGGAGTGCCTTCGGGAACCTGGTGACAGGTGCTGCATGGCT
18 / TGGGTTTGACATGGTAGGAAAAGCCATAGAGATATGGTGTCCTTTTGGGCCTATCACAGGTGGTGCATGGCTGTC
19 / AGGGCTTGACATGACCAGGATCCCGGCGGAAACGTCGGTTCCCCGCAAGGGGCCTGGCCACAGGTGTTGCATGGC
20 / TGGGCTTGACATGTTCCTGACCGGTGTGGAAACACACCTTCCCTTCGGGGCAGGATCACAGGTGGTGCATGGTTG

Supplementary Table 2: Bacterial clones from speleothem D and their closest match in the GenBank database.

Putative Groupa / Clone ID (Accession #) / Closest BLAST Match
(GenBank Accession #) / % identity / organism/source
Acidobacteria / 20C (JN178898) / Uncultured bacterium clone FAC57 (DQ451496) / 95 / forest soil
4F (JN178887) / Uncultured bacterium clone KMS200711-206 (EU881313) / 94 / maize-sweet potato cropland soil
12B (JN178892) / Uncultured bacterium clone p22g18ok (FJ478474) / 96 / undisturbed tall grass prairie, top 5cm
81C (JN178932) / Uncultured bacterium clone p8i13ok (FJ479031) / 97 / undisturbed tall grass prairie, top 5 cm
96E (JN178938) / Uncultured bacterium clone p7i20ok (FJ479521) / 98 / undisturbed tall grass prairie, top 5 cm
27H (JN178905) / Uncultured bacterium clone P803 (GQ214092) / 99 / loess
16G (JN178895) / Uncultured bacterium clone HDB_SIOH1113 (HM185857) / 98 / saturated zone of the Hanford Site 300 Area subsurface
21B (JN178900) / Uncultured bacterium clone HDB_SIPO486 (HM187109) / 96 / saturated zone of the Hanford Site 300 Area subsurface
Actinobacteria / 28G (JN178906) / Aeromicrobium ginsengisoli, Gsoil 137 (AB245395) / 98 / soil of the ginseng field, South Korea
11D (JN178890) / Uncultured bacterium clone 20BSU39 (AJ863189) / 93 / poplar tree microcosm, bulk soil, unflooded
97C (JN178939) / Uncultured bacterium clone p36h07ok (FJ478577);
Uncultured bacterium clone P0X4b3G08 (EU491455) / 94 / undisturbed tall grass prairie, top 5 cm; seafloor lavas from Hawai'i South Point X4
55E (JN178924) / Uncultured bacterium clone p11i04ok (FJ478903) / 97 / undisturbed tall grass prairie, top 5 cm
43F (JN178920) / Uncultured bacterium clone p7j21ok (FJ479595) / 98 / undisturbed tall grass prairie, top 5 cm
30D (JN178908) / Uncultured bacterium clone 2-9A
(EU289511.1) / 94 / endophytes or symbionts enriched from stem bark
59D (JN178925) / Uncultured bacterium clone F2_135X (GQ263011) / 99 / simulated low level waste site
83D (JN178935) / Uncultured bacterium clone FW2_99B (GQ263538) / 99 / simulated low level waste site
2H (JN178885) / Uncultured bacterium clone MACA-OC26 (GQ500878) / 98 / Bio-Sep beads containing 30% limestone, one year in base level cave stream, Owl Cave, Kentucky
66C (JN178928) / Uncultured actinobacterium clone T501C3 (HM437999) / 98 / soil contaminated with anthracene
Chloroflexi / 41F (JN178917) / Uncultured bacterium clone BacC-s_059 (EU335161) / 95 / saturated C horizon soil aggregate
Firmicutes / 65B (JN178927) / Uncultured bacterium clone SMG40 (AM930292) / 99 / composting sample
Gemmatimonadetes / 69C (JN178929) / Uncultured bacterium clone 5-48b (AY955088) / 94 / sediment
Planctomycetes / 29G (JN178907) / Uncultured bacterium clone 3y-30 (FJ444707) / 91 / cotton rhizosphere
8D (JN178888) / Uncultured bacterium clone p6j17ok (FJ478514) / 99 / undisturbed tall grass prairie, top 5 cm
24I (JN178903) / Uncultured bacterium clone p7c17ok (FJ479223) / 92 / undisturbed tall grass prairie, top 5 cm
31G (JN178909) / Uncultured bacterium clone p8g14ok (FJ479427) / 92 / undisturbed tall grass prairie, top 5 cm
82D (JN178933) / Uncultured bacterium clone p8g14ok (FJ479427) / 97 / undisturbed tall grass prairie, top 5 cm
α-Proteobacteria / 53D (JN178923) / Phenylobacterium koreense (AB166881) / 98 / Aerobic sludge
11C (JN178889) / uncultured Green Bay ferromanganous micronodule bacterium MND8 (AF292999) / 95 / Green Bay ferromanganous micronodule
11H (JN178891) / Uncultured bacterium clone L-3 16S (AY625147) / 99 / perchloroethylene-contaminated ground water
39E (JN178914) / Uncultured bacterium clone JH-WH224 (EF492889) / 99 / soil around iron-manganese nodule
18E (JN178897) / Uncultured soil bacterium clone F6-67 (EF688373) / 98 / soil
15H (JN178894) / Uncultured Rhodospirillales bacterium clone Plot17-2E11 (EU440692) / 98 / agricultural soil
25D (JN178904) / Uncultured bacterium clone p27e20ok (FJ478640) / 97 / undisturbed tall grass prairie, top 5 cm
32E (JN178910) / Uncultured bacterium clone p27n19ok (FJ479198) / 99 / undisturbed tall grass prairie, top 5 cm
21G (JN178901) / Alpha proteobacterium KC-IT-F6 (FJ711198) / 99 / stalactite F, Kartchner Caverns
99D (JN178941) / Alpha proteobacterium KC-IT-H1 (FJ711201) / 100 / stalactite H, Kartchner Caverns
17G (JN178896) / Alpha proteobacterium KC-IT-H8 (FJ711206) / 99 / stalactite H, Kartchner Caverns
83E (JN178936) / Alpha proteobacterium KC-IT-W5 (FJ711211) / 99 / stalactite W, Kartchner Caverns
62C (JN178926) / Uncultured Acetobacteraceae bacterium clone Plot18-E03 (FJ889307) / 99 / agricultural soil
52C (JN178922) / Uncultured alpha proteobacterium clone c12-1 (FN594687) / 97 / biofilom from gold mine in Zloty Stok
40H (JN178916) / Uncultured bacterium clone F1_54X2 (GQ262896) / 99 / simulated low level waste site
98C (JN178940) / Uncultured bacterium clone Z22 (GQ388841.1) / 99 / drinking water distribution system during serious red water outbreak;
β-Proteobacteria / 22B (JN178902) / Beta proteobacterium JS666 (AF408397.1) / 100 / isolated from an enrichment culture using cDCE as sole source of carbon
83C (JN178934) / Uncultured bacterium clone M6A-204 (AM991195) / 97 / karst spring water
69D (JN178930) / Uncultured bacterium clone FCPT657 (EF515900) / 98 / grassland soil
20H (JN178899) / Uncultured bacterium clone 1C227004 (EU799410) / 100 / Newport Harbour, RI
41G (JN178918) / Uncultured bacterium clone 658_C22_PCE_column_outflow (FM178827) / 99 / aquifer soil, PCE flow column
42C (JN178919) / Diaphorobacter sp., R-41385
(FR682930) / 99 / soil
γ-Proteobacteria / 32I (JN178911) / Uncultured bacterium clone MIZ12 (AB179503) / 97 / sedimentary rock
33F (JN178912) / Uncultured Gamma proteobacterium clone AMLA2 (AM934929) / 98 / pilot-scale bioremediation process of a hydrocarbon-contaminated soil
39F (JN178915) / Uncultured soil bacterium clone PYR10d3 (DQ123668) / 99 / PAH-contaminated soil
3G (JN178886) / Uncultured bacterium clone P7D1-537 (EF509415) / 100 / endotracheal aspirate
85C (JN178937) / Uncultured bacterium clone FFCH12674 (EU134741) / 96 / soil from an undisturbed mixed grass prairie preserve
δ-Proteobacteria / 12C (JN178893) / Uncultured bacterium clone p25p20ok (FJ478988) / 95 / undisturbed tall grass prairie, top 5cm
35E (JN178913) / Uncultured delta proteobacterium clone 1PJM294 (FJ535064) / 98 / cave wall biofilm, Pajsarjeva jama cave in Slovenia
45B (JN178921) / Uncultured bacterium clone WC3_19 (GQ264089) / 97 / simulated low level waste site

aPutative groups determined after Blast results and phylogenetic trees analysis.

Supplementary Table 3: Phylogenetic assignment and relative abundance of the 20 most abundant OTUs (97% similarity) in Kartchner Caverns. These phylotypes were classified based on a combination of GAST, the Ribosomal Database Project’s Classifier and BLAST analysis against the NCBI database.

OTU / Total number of readsa / % Relative abundance / Cave formations NOT containing this OTU / Phylum / Class / Order / Family
1 / 20,040 / 5.762 / None / Actinobacteria / Actinobacteria / Actinomycetales / Nocardioidaceae
2 / 13,271 / 3.816 / C, D, E, W / Proteobacteria / Deltaproteobacteria / n.d. / n.d.
3 / 12,248 / 3.521 / CA / Actinobacteria / Actinobacteria / Actinomycetales / Sporichthyaceae
4 / 10,382 / 2.985 / None / Actinobacteria / Actinobacteria / Actinomycetales / Nocardioidaceae
5 / 6,565 / 1.887 / C, D, E, F, W / Proteobacteria / Deltaproteobacteria / n.d. / n.d.
6 / 5,916 / 1.701 / A, D, W / Acidobacteria / n.d. / n.d. / n.d.
7 / 5,408 / 1.555 / None / Proteobacteria / Gammaproteobacteria / Xanthomonadales / Sinobacteraceae
8 / 5,394 / 1.551 / CA / Actinobacteria / Actinobacteria / Actinomycetales / Sporichthyaceae
9 / 4,831 / 1.389 / CA, ST / Acidobacteria / Acidobacteria / Acidobacteriales / n.d.
10 / 4,030 / 1.159 / A, CA, Rock, W / candidate division SBR1093 / n.d. / n.d. / n.d.
11 / 3,853 / 1.108 / None / Actinobacteria / Actinobacteria / Rubrobacterales / n.d.
12 / 3,055 / 0.878 / C, CA, ST / Gemmatimonadetes / Gemmatimonadetes / Gemmatimonadales / n.d.
13 / 2,892 / 0.831 / CA, ST / Proteobacteria / Alphaproteobacteria / Sphingomonadales / n.d.
14 / 2,793 / 0.803 / ST / Acidobacteria / Acidobacteria / Acidobacteriales / n.d.
15 / 2,681 / 0.771 / None / Actinobacteria / Actinobacteria / Rubrobacterales / n.d.
16 / 2,610 / 0.750 / A,C, D, W / Acidobacteria / n.d. / n.d. / n.d.
17 / 2,598 / 0.747 / ST, W / Proteobacteria / Gammaproteobacteria / n.d. / n.d.
18 / 2,475 / 0.712 / None / Actinobacteria / Actinobacteria / Acidimicrobiales / n.d.
19 / 2,421 / 0.696 / CA, F, ST / Chloroflexi / n.d. / n.d. / n.d.
20 / 2,387 / 0.686 / None / Actinobacteria / Actinobacteria / Rubrobacterales / n.d.

aThese numbers do not include soil counts

n.d. = could not be determined

1