Microarray-Based Integrated Analysis of Methylation by Isoschizomers (MIAMI) Method

Sup. 1

Preparation of a promoter microarray for the Microarray-based Integrated Analysis of Methylation by Isoschizomers (MIAMI) method

Transcriptional start sites for the genes were characterized on the basis of the NationalCenter for Biotechnology Information (NCBI) annotation and/or Database of Transcriptional Start Sites (DBTSS). A DNA sequence around a transcriptional start site was extracted for each gene and was subjected to megaBlast to select regions whose scores relative to the human genome were less than 30.0. In these regions all possible 60-mer probes in Hpa II fragments were selected from 600 base pairs upstream to 200 base pairs downstream of the transcriptional start site for each gene on the condition that they have a self complementarity score of less than 8.0 by using Primer3. These probes were subjected to megaBlast and the probe nearest to the transcriptional start site, which has a score relative to the human genome of less than 40.0, was selected. Microarrays were made using an ink-jet oligonucleotide synthesizer as described (Hughes et al. 2001).

Microarray-based Integrated Analysis of Methylation by Isoschizomers (MIAMI) method

The procedure is illustrated in Fig. 1a. For the amplification of unmethylated DNA fragments (for Hpa II resistance), 0.5 g of genomic DNA was digested with 40 units of Hpa II overnight in a 100-l volume containing 33 mM Tris-Acetate (pH7.9), 66 mM KOAc, 10 mM MgOAc2, 0.5 mM DTT, and 0.01% BSA. The adaptor was prepared by annealing two oligonucleotides, AGCACTCTCCAGCCTCTCACCGAG and CGCTCGGTGA. After phenol extraction and ethanol precipitation, DNA was ligated to 11 pmol of the adaptor with 60 units of E coli DNA Ligase (Takara, Japan) in a 10-ul volume containing 1 x E coli DNA Ligase buffer (New England Biolabs, USA). The first PCR was performed using 0.1 g of each ligation mix as a template in a 100-l volume containing 2 ul of ligated DNA,1 x LA PCR buffer (Takara, Japan), 100 pmol of the primer AGCACTCTCCAGCCTCTCACCGAG, and 1.25 units of GeneTaq DNA polymerase (Nippon Gene, Japan). The reaction mixture was incubated for 5 min at 72oC and 3min at 94oC and subjected to 5 cycles of amplification consisting of 10 sec denaturation at 94oC, 30 sec annealing at 70oC, 2.5 min extension at 72oC. The final extension was lengthened to 9.5 min. Amplified DNA was digested with Msp I by adding 35 units of the enzyme directly to the solution. After 3-hour incubation,the digestedDNA was subjected to further amplification by a second PCR. The condition was the same as the first PCR except for number of cycles. Optimal sub-saturation cycle number was adopted (usually 10 to 13 cycles).PCR product waspurified with MiniElute PCR purification Kit (Qiagen, USA).For the amplification of all (unmethylated plus methylated, for Msp I resistance) DNA fragments, 0.5 g of genomic DNA was digested with 40 units of Msp I overnight and subjected to the same procedure as for the amplification of unmethylated DNA fragments.

Amplified Hpa II-cleaved DNA fragments from two samples to be compared were labeled with Cy3 and Cy5 respectively as described (Hatada et al., 2002), and cohybridized to a microarray. All hybridization procedure except for the washing was according to the manual of Agilent Technology (USA). Washing was performed for 10 min in 2 x SSC-0.005% Triton X-102 at room temperature, 10 min in 0.2 x SSC- 0.005% Triton X-102 at room temperature, and 10 min in 0.2 x SSC-0.005% Triton X-102 at 65oC. The microarray was scanned using the Scan Array Lite (PerkinElmer) scanner. Fluorescence intensities on a scanned image were quantified, corrected for background noise, and normalized with the software DNASIS Array (Hitachi Software Engineering). Spots with both Cy3 and Cy5 intensities of less than 0.001% of total signalswere removed before subsequent analysis. Amplified Msp I-cleaved DNA fragments from two samples to be compared were labeled with Cy3 and Cy5 respectively, and cohybridized to another microarray with the same genes. Spot intensities were obtained the same as for amplified Hpa II-cleaved DNA fragments. Hpa II resistance (HR) and Msp I resistance (MR) are defined as 1/(normalized Cy3-Hpa II intensity or normalized Cy5-Hpa II intensity) and 1/(normalized Cy3-Msp I intensity or normalized Cy5-Msp I intensity), respectively. Values for log(HRB/HRA) are plotted on the x-axis and values for log(MRB/MRA) are plotted on the y-axis. A regression line was calculated from the genes whose (HRB/HRA)/ (MRB/MRA) value is 20 to 80% of that of genes used for the analysis. In the graph, points located more than log5 of the horizontal distance right of the regression line are judged as hypermethylatedand points located more than this distance left of the regression line were judged as hypomethylated.

We used data from a single experiment for analysis because we could pick up only reproducible results by removing spots with both Cy3 and Cy5 intensities of less than 0.001% of total signals (Supplementary Fig. 2).

1