Dalialfreitak, Eileen Knorr, Heiko Vogeland Andreas Vilcinskas

Environmental stress induced differential and gender specific RNA and microRNA expression in Tribolium castaneum

DalialFreitak, Eileen Knorr, Heiko Vogeland Andreas Vilcinskas

Supplementary Information

Supplementary Material and Methods

(a) Animal breeding and treatment

To monitor miRNA expression upon oral uptake of bacteria, we added 0.3% lyophilized P. entomophila to the diet. Experimental setting of immune responses was done by injecting peptidoglycan from cell walls of Micrococcus luteus (Sigma). About 150 nl of sterile phosphate-buffered saline (PBS) for sham injection or 1 µg/µl peptidoglycan in PBS for immune challenge were injected dorsolaterally into adultT. castaneum. 24 hours post-immune challenge animals were fixed in RNAlater (Ambion). Beetles were subjected to mild heat shock by rearing them at 42 °C for 20 min, followed by incubation for 1 h at 32 °C. Another group consisting of 5 day old beetles was not fed for 5 days to experimentally mimic stress caused by starvation.

(b) Quantitative real-time PCR

For isolation of total RNA, animals were allowed to thaw on ice, RNAlater was removed and total RNA was isolated using miRNAeasy Min Elute columns (Qiagen) according to the manufacturers´ protocol. RNA integrity was verified on an agarose gel. RNA quantity was determined photospectrometrically using a NanoDrop(Peqlab). 500 ng of DNA-free total RNA was converted into single-stranded DNA using a mix of random and oligo-dT20 primers according to the First Strand cDNA Synthesis Kit (Thermo Scientific, Fermentas). Real-time PCR oligonucleotide primers were designed using the online Primer3 internet based interface ( Primers were designed by the rules of highest maximum efficiency and sensitivity. These rules were followed to avoid formation of self and hetero-dimers, hairpins and self-complementarity.

Reverse transcription-quantitative PCR (RT-qPCR) of selected miRNAs was performed using the miRNA-enriched material isolated with the miRNAeasy Min Elute kit as described above which was also used for the microarray hybridizations. Generation of cDNA for RT-qPCR was done using theQiagenmiRNA first-strand synthesis and qPCR kit (miScript II; Qiagen) according to the manufacturer’s instructions. Small RNA-enriched total RNA was reverse transcribed in HiFlex buffer using modified oligo-dT primerswhich have a 3' degenerate anchor and a universal tag sequence on the 5' end allowing amplification of mature miRNA in the real-time PCR step. The combination of polyadenylation and the universal tag addition ensures that miScript Primer Assays do not detect genomic DNA. Custom miScript primers for the selected Tribolium miRNAs were designed with the miScriptmiRNA product design webpage (Qiagen). We selected three different miRNAs which showed uniform expression levels across samples for data normalization (reference or housekeeping miRNAs) and sevenmiRNAs which showed a sex- and/or treatment effect in expression levels based on our miRNA microarray data. Real-time PCR detection was performed on an Mx3000P (Agilent)with the miScript SYBR Green PCR Kit (Qiagen). Real-time PCR conditions were an initial 95°C for 15 min (activation of Hot Start Polymerase), and 40 cycles of 94°C for 15 s, 55°C for 30 s, and 70°C for 30 s. PCR products were subsequently analyzed by a melting curve analysis. Relative miRNA expression, determined by real time RT-PCR, was normalized to the expression of the reference miRNAs and using the ΔΔCt method as described in detail by Livak and Schmittgen[1]. We used a cutoff value of 2.00, with samples having a 2-ΔΔCt value above 2.00 considered positive for overexpression. The selected tester miRNA sequences for primer design and qRT-PCR are as follows: ame-miR-13b (UAUCACAGCCAUUUUUGACGAUU), ame-miR-79 (UAAAGCUAGAUUACCAAAGCA), bmo-miR-989 (GUGUGAUGUGACGUAGUGGAA), dme-miR-954 (UCUGGGUGUUGCGUUGUGUGU), dme-miR-1017 (GAAAGCUCUACCCAAACUCAUCC), tca-miR-540 (AGGUCAGAGGUCGCUACUGG), aga-miR-989 (UGUGAUGUGACGUAGUGGUAC). The selected control (normalizer) miRNA sequences are as follows: tca-miR-13a (UAUCACAGCCACUUUGAUGAGC), tca-miR-317 (UGAACACAGCUGGUGGUAUCUCAGU), tca-miR-8 (UAAUACUGUCAGGUAAAGAUGUC).

(c) miRNA reference sets and miRNA microarray assay

The assays were done on 5µg of total RNA samples from 2 biological replicates (each replicate consisted of pooled RNA sample originating from 15 animals) of Tribolium female and male adults from different treatments, where one biological replicate was labeled with Cy3 and the other with Cy5. Labeled samples were co-hybridized on one chip. Total RNA samples were fractionated using the mirVana Isolation Kit (Ambion, USA).The small RNAs (<200 nt) were 3’-extended with a poly(A) tail using poly(A) polymerase. An oligonucleotide tag was then ligated to the poly(A) tail to alter staining with fluorescent dye. Hybridization was made overnight on a µParaFlomicrofluidic chip using a micro-circulation pump (Atactic Technologies, Houston, USA). On the microfluidic chip, each detection probe consisted of a chemically modified nucleotide coding segment complimentary to the target miRNA (miRBase, or other RNA (control or our defined sequences) and a spacer segment of polyethylene glycol to keep the coding segment away from the substrate. Detection probes were made by in situ synthesis using photogenerated reagent (PGR) chemistry. The hybridization melting temperatures were balanced by chemical modifications of detection probes. After hybridization, signals were detected using fluorescence labeling with tag-specific Cy3 and Cy3 dyes (Invitrogen, Carlsbad, USA). Hybridization images were collected using a laser scanner (GenePix 4000B, Molecular Device, Sunnyvale, USA) and quantified. For each chip and each probe, the average signal value and its standard deviation were quantified. Data were analyzed by first subtracting the background, then integrating all the signals corresponding for the same probe for one given chip. A transcript to be listed as detectable must meets at least two conditions: signal intensity higher than 3× (background standard deviation) and spot CV < 0.5. Since repeating probes are present on an array, a transcript is listed as detectable only if the signals from at least 50% of the repeating probes are above detection level. Normalization of the signals from all arrays were performed using a LOWESS filter (Locally-weighted Regression). Intensity values were transformed into log2 scale, and fold changes were given in log2 scale.Results obtained in the different treatments were compared by comparing the ratio of the two sets of detected signals (log2) and p-values of the t-test and 2-Way ANOVA were calculated. Differentially detected signals were defined as those with a p-value < 0.05. Data classification involved a hierarchical clustering method using average linkage and Euclidean distance metric, and was visualized with TIGR’s MeV (Multiple Experimental Viewer; Institute for Genomic Research).

Supplementary data analysis

(a) qPCR with microRNAs

In order to verify our microarray data set, we analyzed expression levels of seven miRNAs with RT-qPCR. For correction of sample-to-sample variation we selected three miRNAs with constant expression as potential endogenous controls (reference miRNAs) based on our microarray data. All selected reference miRNAs displayed uniform expression across all samples in RT-qPCR assays, confirming our microarray data. For the analysis and normalization of the RT-qPCR data of the tester miRNAs, we have subsequently used two of the reference miRNAs, namely tca-miR-13a and tca-miR-317. With the exception of a single miRNA, all miRNAs analyzed by RT-qPCR matched microarray expression data. For example aga-miR-989 and bmo-miR-989 displayed highest expression levels in female Triboliumupon all treatments when compared to adult males (appr. 10-15fold) but also lower expression in both males and females uponstarvation (appr. 3fold) while tca-miR-540 is lowest in both untreated males and females and inducible (appr. 2fold) by bacteria and heat treatments. The induced expression of dme-miR-954 is more pronounced in males versus females in most treatments, except for PGN-injected females, but generally lower in both sexes under starved conditions (appr. 2-5fold). In contrast to this, themiRNAame-miR-13b is lowest in control versus PGN injections in both sexes. Furthermore, in general the relative expression levels obtained by our microarray analyses matched well with the relative expression based on Ct values obtained from the RT-qPCR analysis for the selected miRNAs. One of the miRNAs tested (dme-miR-1017) did not match the expression differences found in our microarray analyses between treatments. However, closer inspection of the Ct values (33 cycles) revealed that amplification was poor. The subsequent combined analysis of both themelting curve and the Ct values lead to the conclusion that the primer did not work properly. As a general conclusion, both starvation and heat stress seem to be strong stimuli for changes in miRNA gene expression in T. castaneum, and were consistently identified in both our microarray and RT-qPCR assays.

(b) Gender and treatment specific miRNA expression

A 2-Way ANOVA was conducted to study the interaction between genders and treatments on the miRNA expression. In total 221 miRNA species showed differential expression between genders and treatments (Supplementary Table 2).

(c) Expression profiling of TriboliummiRNAs

After microarray hybridization and statistical analyses, a hierarchical clustering algorithm was applied to the data and a microarray heat map was generated, identifying a set of differentially exrpressedTriboliummiRNAs in naive females and males (A), P. entomophila fed vs. naive animals (B), peptidoglycan injected vs. sham injected (C), heat treated vs. naive (D) and hungered vs. naive (E). Two replicates of both genders per treatment are indicated (labeled Males and Females 1-2). Color coding: red, up regulated; green, down regulated; black, not regulated. The log score for fold change is indicated (supplementary figure 1).

References

1 Livak, K.J. & Schmiitgen, T.D. 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.Methods25 402-8.